Back to top

Sondes d'Amorçage pour la Détection du SARS-CoV-2

Primer-Probe Sets for the Detection of  SARS-CoV-2
 
 
Pour aider à accélérer les travaux des chercheurs sur le nouveau coronavirus, Microsynth fournit désormais des amorces et des sondes prêtes à l'emploi pour la détection et l'identification du SARS-CoV-2. Ces amorces et sondes prêtes à l'emploi seront mises à disposition pour être expédiées immédiatement, avec un réapprovisionnement rapide si nécessaire. Nous avons l'intention de donner la priorité à tous les projets liés au coronavirus (SARS -CoV-2) aussi longtemps que cela sera nécessaire.
 
Utilisation à des fins de recherche uniquement. Ne pas utiliser dans les procédures de diagnostic.
 

Caractéristiques et Avantages

 
 
Transport Rapide
  • Expédition le jour même si vous commandez jusqu'à midi, sinon le jour ouvrable suivant
  • Par courrier express gratuit
 
Haute Qualité
  • Fabrication dans un laboratoire de synthèsse certifié ISO 13485:2016
  • Contrôle qualité strict comprenant un test de fonctionnalité qPCR (contrôle positif et no template control avec Cp <40) avant la libération des lots
  • Les oligos sont expédiés à partir d'une installation "propre" puisque nous ne synthétisons pas les contrôles positifs
 
 
 
Pratique
  • Sondes et amorces pour 1'000 réactions (avec concentration prête à l'emploi selon le protocole Charité/Berlin)
  • Couvrant la plupart des instruments de qPCR (y compris les systèmes cobas®6800/8800 de Roche)
 
 
Recommandé par l'OMS
  • Séquences d'amorces et de sondes avec les mêmes technologies Dye que celles recommandées par l'OMS
  • Transparence totale concernant les informations sur les séquences
 

Products

 
E_Sarbeco Primer-Probe Set
Numéro d'article : 1600
Nom Amorces & Sondes Sequences Modification Rendement (nmol)1 Condition Physique Prix [EUR]
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT   30 liquide 450.-
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA   30
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 5'6-FAM, 3'BHQ1 10
 
Informations sur les produits :
 
 
E_Sarbeco Primer-Probe Set cobas®
Numéro d'article : 1610
Nom Amorces & Sondes Sequences Modification Rendement (nmol)1 Condition Physique Prix [EUR]
E_Sarbeco_F1 ACAGGTACGT TA ATAGT TA ATAGCmGT   90 liquide 860.-
E_Sarbeco_R2 ATATTGCAGCAGTACGCACAmCA   90
E_Sarbeco_P1 ACACTAGCC/iQ500/ATCCTTACTGCGCTTCG 5'6-FAM, 3'BHQ1 15
 
Informations sur les produits :
 
RdRP_SARS Primer-Probe Set
Numéro d'article : 1620
Nom Amorces & Sondes Sequences Modification Rendement (nmol)1 Condition Physique Prix [EUR]
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG   30 liquide 640.-
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA   30
SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 5'6-FAM, 3'BHQ1 10
SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 5'6-FAM, 3'BHQ1 10
 
Informations sur les produits :
 
 
1 Convient pour au moins 1'000 réactions PCR (25 µl de volume) 

Comment Commander

 
 
Passez votre commande en écrivant un courriel à info@microsynth.ch et en précisant les éléments suivants :
  • Numéro d'article souhaité
  • Nombre requis de sets d'amorces-sondes
  • Votre adresse de livraison et de facturation
 
Remarque importante :
Nous n'acceptons actuellement aucune commande de contrôles positifs d'oligonucléotides synthétiques liés à une séquence de coronavirus.
Au cas où vous auriez besoin d'un contrôle positif, nous vous prions de vous adresser à la source suivante : https://www.european-virus-archive.com/